View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17718_low_19 (Length: 241)
Name: NF17718_low_19
Description: NF17718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17718_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 51459335 - 51459552
Alignment:
| Q |
18 |
catagatactgtttttgctgttcccaattaaaacaa--ttacaagacacgtgtactattttaacacccaattttaaggtcgtcagcttttgttagtttag |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51459335 |
catagatactgtttttgttgttcccaattaaaacaagattacaagacacgtgtactattttaacacccaattttaaggtcgtcagcttttgttagtttag |
51459434 |
T |
 |
| Q |
116 |
tcacacaggataaatag--taccacctctctggacagaaataagggcagccattgcaaggcttgctctcaccgtggatgtcacataaagcactcattggt |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51459435 |
tcacacaggataaatagagtaccacctctctggacagaaataagggcagccattgcaaggtttgctctcaccgtggatgtcacataaagcactcattggt |
51459534 |
T |
 |
| Q |
214 |
tgtataattcttcctatg |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51459535 |
tgtataattcttcctatg |
51459552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 53
Target Start/End: Complemental strand, 51461045 - 51461016
Alignment:
| Q |
24 |
tactgtttttgctgttcccaattaaaacaa |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51461045 |
tactgtttttgctgttcccaattaaaacaa |
51461016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University