View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_high_13 (Length: 236)
Name: NF17719_high_13
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_high_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 42086524 - 42086744
Alignment:
| Q |
16 |
gttctgtcaaccggttcacgaggtaaagtaggtggaataaaccctaaagtttgtaaagaatggcttgatacaaaaccttcaaattcggtgttatttgttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086524 |
gttctgtcaaccggttcacgaggtaaagtaggtggaataaaccctaaagtttgtaaagaatggcttgatacaaaaccttcaaattcggtgttatttgttt |
42086623 |
T |
 |
| Q |
116 |
gttttggatcgatgaacacaatttctgctacacagatgatgcaacttggaacggcgttggaaaaaagtggaaagaatttcatctgggtagtgaggccacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086624 |
gttttggatcgatgaacacaatttctgctacacagatgatgcaacttggaacggcgttggaaaaaagtggaaagaatttcatctgggtagtgaggccacc |
42086723 |
T |
 |
| Q |
216 |
aataggttttgatataaactc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42086724 |
aataggttttgatataaactc |
42086744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University