View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_high_15 (Length: 212)
Name: NF17719_high_15
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 45466737 - 45466916
Alignment:
| Q |
17 |
gaaagtgacttttacgggtgtatagccttcccctccatgatattttcattacagagggccacttcggatgacccttagaatgtgttggaggcaaaggttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45466737 |
gaaagtgacttttacgggtgtatagccttcaccttcatgatattttcattacagagggccacttcagatgacccttagaatgtgttggaggcaaaggttt |
45466836 |
T |
 |
| Q |
117 |
ttgaccgcagaagaatggactttgttggaacattcccatgatcatgcgaaaatgaatacattttggtagctgctgattat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45466837 |
ttgaccgcagaagaatggactttgttggaacattcccatcatcatgcgaaaatgaatacattttgttagctgctgattat |
45466916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University