View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_low_11 (Length: 250)
Name: NF17719_low_11
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_low_11 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 42087048 - 42086811
Alignment:
| Q |
13 |
aatatcttcatacttcacttcacaactctttcctctagcaacctcaacacaaacacccatctcttcttccaacagcttacaattaaaaaactgctccgcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087048 |
aatatcttcatacttcacttcacaactctttcctctagcaacctcaacacaaacacccatctcttcttccaacagcttacaattaaaaaactgctccgcc |
42086949 |
T |
|
| Q |
113 |
gccatcggccacccaagaataggtacaccatgactcaatgattccaacactgagttccaaccacaatgactcaaaaacgcagaaactgatccatgtgata |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42086948 |
gccatcggccacccaagaataggtacaccatgactcaatgattccaacaccgagttccaaccacaatgactcaaaaacgcagaaactgatccatgtgaca |
42086849 |
T |
|
| Q |
213 |
atatctcaacttgtggtgcccaatcatttactattata |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42086848 |
atatctcaacttgtggtgcccaatcatttactattata |
42086811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 189
Target Start/End: Original strand, 24462261 - 24462298
Alignment:
| Q |
152 |
gattccaacactgagttccaaccacaatgactcaaaaa |
189 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
24462261 |
gattccaacactgagttccatccacaatgagtcaaaaa |
24462298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University