View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_low_14 (Length: 235)
Name: NF17719_low_14
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 5898101 - 5898308
Alignment:
| Q |
18 |
ggttcaaactttagaatactcaaattatcttgtccaaacactaatcatcttgaatttgatnnnnnnnn-ttcccttgacatatatgaataataatcaatc |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5898101 |
ggttcaaactttagaagactcaaattatctcgtccaaacacaaatcatcttgaatttgataaaaaaaaattcccttgacatatatgaataataatcaatc |
5898200 |
T |
|
| Q |
117 |
attgacctacattttgcttaatactaacgcgtcctaccaaattgaaatgtttatttattttaatttcaaactgttcaagtaaattgaatactaacatata |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5898201 |
attgacctacattttgcttaatactaatgcgtgctaccaaattgaaatgtttatttattttaatttcaaactgttcaagtaaattgaatactaacatatt |
5898300 |
T |
|
| Q |
217 |
ttcttcga |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
5898301 |
ttcttcga |
5898308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University