View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_low_3 (Length: 419)
Name: NF17719_low_3
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 43591487 - 43591232
Alignment:
| Q |
18 |
ttgatggtgccaattttagcctgtgctaatgtggttgtgactaaatcttaaataattgttttgaattttggtgatgcttaatattattagtgttaaaatt |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43591487 |
ttgatggtgccaattttagccggtgctaatgtggttgtgactaaatcttacataattgttttgaattttggtgatgcttaatattacgagtgttaaaatt |
43591388 |
T |
 |
| Q |
118 |
ttgaattttgattcctactttttctagttatatacccattttgcctttt-taaaagaaagaattcgattccttcaaactgttattaaaaatcaaaacctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43591387 |
ttgaattttgattcctactttttctagttatata-ccattttgccttttaaaaaaaaaagaattcgattccttcaaactgttattaaaaatcaaaacctt |
43591289 |
T |
 |
| Q |
217 |
gctggtttaatgctacattcgagaattaatctgttaaaacatatatatactcattca |
273 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43591288 |
gctggtttagtgctacattcgagaattaatctgttagaacatatatatactcattca |
43591232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University