View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_low_4 (Length: 354)
Name: NF17719_low_4
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 337
Target Start/End: Original strand, 10111001 - 10111321
Alignment:
| Q |
18 |
ctagtatccgccgtacaattttctagcacggcgttccggcaaactaccatggtttccggcagggtttcacccatgacatcgatgatgggaaggcctgatc |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10111001 |
ctagtatccgccgtacaattttccagcacggcgttccggcaaactaccgtggtttccggcagggtttcacccatgacatcaatgatgggaaggcctgatc |
10111100 |
T |
|
| Q |
118 |
gctaggttgaaaggttataaattgttatggnnnnnnnnnnnnnnnnnnnnnncaataaaaaatgcacaattactttgtcaatttt-gtatcggcaagaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
10111101 |
gctaggttgaaaggttataaattgttatggtttttttacactttttgtttttcaataaaaaattcacaattactttgtcaatttttgtatcgacaagaat |
10111200 |
T |
|
| Q |
217 |
tttgattgaggattatattccatttaatttagtttcttcattgttgttttgattaattaatctatggtgtgttgtatggtgtaatgctacctattattac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10111201 |
tttgattgaggattatattccatttaatttagtttcttcattgttgttttgattaattaatctatggtgtattgtatggtgtaatgctacctattattac |
10111300 |
T |
|
| Q |
317 |
ctagtttatgtttatggaatt |
337 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
10111301 |
ctagtttatgtttatgtaatt |
10111321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University