View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_low_6 (Length: 313)
Name: NF17719_low_6
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_low_6 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 6913568 - 6913377
Alignment:
| Q |
1 |
tctgaaactgcatgagatgatgaaagagagtggttaaacaataagattatggctacgatgaacatgggattggaattgaaataaactagttttgctataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6913568 |
tctgaaactgcatgagatgatgaaagagagtggttaaacaataagattatggttacgatgaacatgggattggaattgaaataaactagttttgctataa |
6913469 |
T |
 |
| Q |
101 |
aggaagaaatggttaaggcagctgcatcaagagaaagaaaagggcggttcattttgaaacccaagtagtgtggtaaaagataagaagagtga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6913468 |
aggaagaaatggttaaggcagctgcatcaagagaaagaaaaggacggttcattttgaaacccaagtagtgtggtaaaagataagaaaagtga |
6913377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 216 - 285
Target Start/End: Complemental strand, 84091 - 84023
Alignment:
| Q |
216 |
attcatgctcctcgttacttaagtgccgaaggagttttcttttataaaaattgcttcggcagttaactgc |
285 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
84091 |
attcatgctcttcagtacttaagtgccgaaggagttttctttt-taaaaattgtttcggcagttaactgc |
84023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 216 - 289
Target Start/End: Complemental strand, 36127499 - 36127427
Alignment:
| Q |
216 |
attcatgctcctcgttacttaagtgccgaaggagttttcttttataaaaattgcttcggcagttaactgccgag |
289 |
Q |
| |
|
||||||||| | || |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
36127499 |
attcatgcttcacggtacttaagtgccgaaggagttttctttt-taaaaattgcttcggtagttaactgtcgag |
36127427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 272
Target Start/End: Original strand, 26184552 - 26184607
Alignment:
| Q |
216 |
attcatgctcctcgttacttaagtgccgaaggagttttcttttataaaaattgcttc |
272 |
Q |
| |
|
|||||||||||||| || |||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
26184552 |
attcatgctcctcgatatttaaatgccgaaaaagttttctttt-taaaaattgcttc |
26184607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University