View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17719_low_7 (Length: 300)
Name: NF17719_low_7
Description: NF17719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17719_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 55 - 278
Target Start/End: Complemental strand, 32791856 - 32791635
Alignment:
| Q |
55 |
tacaaggggtgacacagacagcttctatacnnnnnnnccttttgaatcataattctctaataaaataatattctctcttattctctttttgtcttctttg |
154 |
Q |
| |
|
||||| |||||||||||||||| ||||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32791856 |
tacaaagggtgacacagacagcctctatactttttttc-ttttcaatcataattctctaataaaataatattctctcttattctctttttgtcttctttg |
32791758 |
T |
|
| Q |
155 |
ttaaaaccccaagcaagccccacattccatccctctctcttcccttgatcccctagagctaatttgtctctcccacnnnnnnncatttggatcttcttct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32791757 |
ttaaaaccccaagcaagccccacattccatccctctctcttcccttgatcccattgagctaatttgtctctcccac-tttcttcatttggatcttcttct |
32791659 |
T |
|
| Q |
255 |
tcccttaggtccttctctttctct |
278 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32791658 |
tcccttaggtccttctctttctct |
32791635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University