View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_high_21 (Length: 323)
Name: NF1771_high_21
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_high_21 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 270 - 323
Target Start/End: Complemental strand, 17523458 - 17523405
Alignment:
| Q |
270 |
gaaggaaaatttaatacagcttaattaccattattataaaattaattgattttt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17523458 |
gaaggaaaatttaatacagcttaattaccattattataaaattaattgcttttt |
17523405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 176 - 224
Target Start/End: Complemental strand, 17523552 - 17523504
Alignment:
| Q |
176 |
accgacatatgccacttctacgtcctcacacctcacacaaaacaacacc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17523552 |
accgacatatgccacttctacgtcctcacacctcacacaagacaacacc |
17523504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 48 - 96
Target Start/End: Complemental strand, 17523681 - 17523633
Alignment:
| Q |
48 |
caatgccaagacatattccaaagtttctgctgagttcttcagtcactag |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || |||||||| |
|
|
| T |
17523681 |
caatgccaagacatattccaaagtttctgctcagttcctcggtcactag |
17523633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University