View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_high_30 (Length: 242)
Name: NF1771_high_30
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_high_30 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 36324007 - 36323773
Alignment:
| Q |
9 |
ttatactaataatttatttattttccaaatatctgaaaatttgtttcca--attctcccattaattttttaactttcaatatttttatcgaaaaaagaca |
106 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
36324007 |
ttatactactaatttatttattttccgaatatcagaaaatttgtttccatgattctcccattaatttgt-aactttcaatatttttatcgagaaaagaca |
36323909 |
T |
|
| Q |
107 |
tacgaccatgttagtggccgtctgcacgctagctagtttaatatagtatacctgcagtatctcaacaattggattagttctttgtgcaacatgaatccgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36323908 |
tacgaccatgttagtggccgtctgcaccctagctagtttaatatagtatacctgcagtatctcaacaattggattagttctttgtgcaacatgaatccgg |
36323809 |
T |
|
| Q |
207 |
tatagtggaaatccaaaggcaaaggtgatcatagca |
242 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36323808 |
tatagtggtaatccaaaggcaaaggtgatcatagca |
36323773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 36330682 - 36330619
Alignment:
| Q |
179 |
attagttctttgtgcaacatgaatccggtatagtggaaatccaaaggcaaaggtgatcatagca |
242 |
Q |
| |
|
|||||||||||||||| ||||||| | ||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
36330682 |
attagttctttgtgcagcatgaattctgtatagtggcaatccaagggcaaagatgatcatagca |
36330619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University