View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_high_35 (Length: 237)
Name: NF1771_high_35
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_high_35 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 16624 - 16843
Alignment:
| Q |
1 |
ctataatttcaatgattcattcatcttatttttcaacaaacaatttaaagtagcgacaattccacgagtcagtgcttaaccttttgagatatttacactg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
16624 |
ctataatttcaatgattcattcatcttatttttcaacaaacaatttaaagtagcgacaattccacgaatcagtgcttaatcttttgagatatttacactg |
16723 |
T |
|
| Q |
101 |
caaaattaaatttttatggttattgtgagcacatacctattgattgatttacagctttcatgcagagattctcataatactcttttcccctgtgactgca |
200 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16724 |
caaaattaaatttttgggattattgtgagcacatacctattgattgatttacagctttcatgcagagattctcataatactcttttcccctgtgactgca |
16823 |
T |
|
| Q |
201 |
acttcttaatatgtcaaagc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
16824 |
acttcttaatatgtcaaagc |
16843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University