View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_high_37 (Length: 235)
Name: NF1771_high_37
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 15151371 - 15151587
Alignment:
| Q |
1 |
atatcgattttgatctatttataaaggctataattttctatataccaccctaaaaagtaagctataattttcttgttaaaaa-tctcgcaccatgtaaga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| | |||| ||| | |||| |
|
|
| T |
15151371 |
atatcgattttgatctatttataaaggctataattttctatatacctccctaaaaagtaagctataattttcttattaaagagtctcacactagacaaga |
15151470 |
T |
 |
| Q |
100 |
gatgatttgacatgtgtttataagtggaggtaatcataaatttataagccagttttgcaaggatcatttagtaccaggcacgaggggtttgtttaaggcc |
199 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15151471 |
gatgattttacatgtgtttataagtgagggtaatcataaatttataagtcagttttgcaaggatcatttagtaccagacacgaggggtttgtttaaggcc |
15151570 |
T |
 |
| Q |
200 |
atatgcttgtttaaggc |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15151571 |
atatgcttgtttaaggc |
15151587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University