View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1771_high_38 (Length: 235)

Name: NF1771_high_38
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1771_high_38
NF1771_high_38
[»] chr4 (1 HSPs)
chr4 (1-221)||(51915211-51915431)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 51915211 - 51915431
Alignment:
1 taccaccaccgggagaagccatgagatagcccttggagaagcttcgagcaccaatgagttttttgttacagagtgaagaatcgaaatctggtgctgattc 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51915211 taccaccaccaggagaagccatgagatagcccttggagaagcttcgagcaccaatgagttttttgttacagagtgaagaatcgaaatctggtgctgattc 51915310  T
101 acactttccacgccatcgagatgggatttgaggcatttgagaatcgagaaaactttgcgattctggccatactccagtgtcaagtacaccaataacaacg 200  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||    
51915311 acactttccacgccatcgagatgggatttgaggaatttgagaatcgtaaaaactttgcgattctggccatactccagtgtcaagtacaccaataacaacg 51915410  T
201 tcgtatgaaggttggtgaaga 221  Q
    |||||||||||||||||||||    
51915411 tcgtatgaaggttggtgaaga 51915431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University