View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_26 (Length: 265)
Name: NF1771_low_26
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 52 - 233
Target Start/End: Original strand, 36323614 - 36323795
Alignment:
| Q |
52 |
aaaagatcccaaagaagcaagacaaatgtccagcttctttaatggtctcttgcttgcaatttgcgttggtggttctgtcagcttaacttttaatgtatgg |
151 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36323614 |
aaaagatcccaaagaaacaagacaaatgtccagcttctttaatggtctcttgcttgcaatttgcgttggtggttctgtcagcttaacttttaatgtatgg |
36323713 |
T |
|
| Q |
152 |
atacaagacaacaaaggatgggatttgggtttgggaatctccaccattgctattgtctttgctatgatcacctttgcctttg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36323714 |
atacaagacaacaaaggatgggatttgggtttgggaatctccaccattgctattgtctttgctatgatcacctttgcctttg |
36323795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 52 - 229
Target Start/End: Original strand, 36330460 - 36330637
Alignment:
| Q |
52 |
aaaagatcccaaagaagcaagacaaatgtccagcttctttaatggtctcttgcttgcaatttgcgttggtggttctgtcagcttaacttttaatgtatgg |
151 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||| ||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
36330460 |
aaaagatcccaaagaaacaagacaaatgtctagcttctttaatgctctcttgcttgctgtttgcattggtggttctgtcagcttaacatttaatgtatgg |
36330559 |
T |
|
| Q |
152 |
atacaagacaacaaaggatgggatttgggtttgggaatctccaccattgctattgtctttgctatgatcacctttgcc |
229 |
Q |
| |
|
|||||| ||| |||||||||||||| ||| || ||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36330560 |
atacaaaacagcaaaggatgggattggggatttggaatatccaccattgctattgtctttgctatgatcatctttgcc |
36330637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 52 - 176
Target Start/End: Original strand, 37919962 - 37920086
Alignment:
| Q |
52 |
aaaagatcccaaagaagcaagacaaatgtccagcttctttaatggtctcttgcttgcaatttgcgttggtggttctgtcagcttaacttttaatgtatgg |
151 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||| ||||||| |||||| |||| ||||| ||| ||||||||||| |||||| |||||||||| | |
|
|
| T |
37919962 |
aaaagatctcaaagaaacaagacaaatgtctagcttatttaatgttctcttacttgttgtttgcattgatggttctgtcaacttaacatttaatgtatag |
37920061 |
T |
|
| Q |
152 |
atacaagacaacaaaggatgggatt |
176 |
Q |
| |
|
|||||| ||| |||||| ||||||| |
|
|
| T |
37920062 |
atacaaaacagcaaagggtgggatt |
37920086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 55 - 176
Target Start/End: Original strand, 5458883 - 5459004
Alignment:
| Q |
55 |
agatcccaaagaagcaagacaaatgtccagcttctttaatggtctcttgcttgcaatttgcgttggtggttctgtcagcttaacttttaatgtatggata |
154 |
Q |
| |
|
|||||||||||||| || ||||||||| |||||||||| |||||||||||| ||||| | |||||| | |||||||||||||| | |||||||||| |
|
|
| T |
5458883 |
agatcccaaagaagaaaagaaaatgtccacattctttaatgttctcttgcttgctgtttgcatgggtggtgcagtcagcttaactttcattgtatggata |
5458982 |
T |
|
| Q |
155 |
caagacaacaaaggatgggatt |
176 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
5458983 |
caaatcaacaaaggatgggatt |
5459004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University