View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_30 (Length: 247)
Name: NF1771_low_30
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_30 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 16496 - 16258
Alignment:
| Q |
1 |
tttgaagtttcgctacaatgaccaaatcgtgttatgtgtacaatctcaaagactaaactggcggtactttcaaataaccctatagtctcgattaagatgt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16496 |
tttgaaatttcgctacaatgaccaaatcgtgttatgtgtacaatctcaaagactaaactggcggtactttcaaataaccctatagtctcgattaagatgt |
16397 |
T |
 |
| Q |
101 |
ttgatgctgcatacagtgagagttaaacctctcggaggatccactacttcattgaattgcacatctctaaaacataacggttttccagtacttattaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16396 |
ttgatgctgcatacagtgagagttaaacctctcggaggatccactacttcattgaattgcacatctctaaaacattacggttttccagtacttattaaga |
16297 |
T |
 |
| Q |
201 |
aataatgactgtttagcatctttatggatttcctctgtg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16296 |
aataatgactgtttagcatctttatggatttcctgtgtg |
16258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University