View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_33 (Length: 239)
Name: NF1771_low_33
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_33 |
 | |
|
| [»] scaffold0361 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 6436381 - 6436163
Alignment:
| Q |
2 |
gagatgaaggatgctctttcattttggtcactattgccacctcacagcttacatgtctccnnnnnnnnnnnnncaactcagnnnnnnngtagagttaaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
6436381 |
gagatgaaggatgctctttcattttggttactattgccacctcacagcttacatgtct---aaaaaaaaaaaaaaactcagtttttttgtagagttaaca |
6436285 |
T |
|
| Q |
102 |
gccaaatctaaagtcggagaccaaagtggttaacaaattttgaagtcagggaatttttcttgttttctcttgagttagggaccattatgacaatgaggtg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6436284 |
gccaaatctaaagtcggagaccaaagtggttaacaaattttggagtcagggaatttttcttgttttctcttgagttagggaccattatgacaatgaggtg |
6436185 |
T |
|
| Q |
202 |
ctcatccaaggaccaaaaaggt |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6436184 |
ctcatccaaggaccaaaaaggt |
6436163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 2 - 155
Target Start/End: Original strand, 5476 - 5628
Alignment:
| Q |
2 |
gagatgaaggatgctctttcattttggtcactattgccacctcacagcttacatgtctccnnnnnnnnnnnnncaactcagnnnnnnngtagagttaaca |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||| || ||||||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
5476 |
gagatgaaagatgctctttcattttggtccctgttgccacctcacaacttacatgtctccaaacaagaaataccaactcagttttttt-tagagttaacg |
5574 |
T |
|
| Q |
102 |
gccaaatctaaagtcggagaccaaagtggttaacaaattttgaagtcagggaat |
155 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
5575 |
accaaatctaaagttggagactaaagtggttaacaaattttggagtcaaggaat |
5628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 200
Target Start/End: Complemental strand, 17240724 - 17240626
Alignment:
| Q |
102 |
gccaaatctaaagtcggagaccaaagtggttaacaaattttgaagtcagggaatttttcttgttttctcttgagttagggaccattatgacaatgaggt |
200 |
Q |
| |
|
||||||| ||| ||||| ||| ||||||| ||| ||||||||||||||||| | ||| | |||| |||||||| | |||||||||||||| ||||| |
|
|
| T |
17240724 |
gccaaatttaacgtcggggactaaagtggctaatgaattttgaagtcagggactcttttgtattttttcttgagtcggagaccattatgacaacgaggt |
17240626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University