View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_35 (Length: 238)
Name: NF1771_low_35
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_35 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 142 - 238
Target Start/End: Complemental strand, 16612253 - 16612157
Alignment:
| Q |
142 |
aatgcacaaatattaatggaatattaacatgtgcttttaaggtataagttaacatgaccctatttatatatggaaaaaattaagaatgtgttacttt |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | | || ||||||| | |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16612253 |
aatgcacaaatattaatggaatattaatatgtgcttttaggacacaatttaacataattctatttatatatgggaaaaattaagaatgtgttacttt |
16612157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 16612377 - 16612322
Alignment:
| Q |
16 |
cattgactaattcagagttgtgatatttatatgaaaaatgttaagggcacaagtta |
71 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16612377 |
cattgactaattcagagtcgtgatatttatatggaaaatgttaagggcacaagtta |
16612322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 50524268 - 50524231
Alignment:
| Q |
165 |
ttaacatgtgcttttaaggtataagttaacatgaccct |
202 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50524268 |
ttaacatgtgctttaaaggcataagttaacatgaccct |
50524231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 166
Target Start/End: Original strand, 45069977 - 45070005
Alignment:
| Q |
138 |
gttgaatgcacaaatattaatggaatatt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45069977 |
gttgaatgcacaaatattaatggaatatt |
45070005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University