View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_36 (Length: 237)
Name: NF1771_low_36
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 9277009 - 9277226
Alignment:
| Q |
1 |
ttaaggagttcaattgcgaagattcacacatacagttgtgaacattattaactacaatgaatattatgtaactgacaaggaccaagatagatcggtggat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9277009 |
ttaaggagttcaattgcaaagattcacacatacagttgtgaacattattaactacaat---aagtatgtaactgacaaggaccaagatagatcggtggat |
9277105 |
T |
 |
| Q |
101 |
gaatgatatatcagcccataagttggatagtagaccagaacagtgaacgctaagaaagtgactgcaactttaactttccatgttttgtggagaaaaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9277106 |
gaatgatatatcagcccataagttggatagtagaccagaacagtgaacgctaagaaagtgactgcaactttaactttccatgttttgtggagaaaaataa |
9277205 |
T |
 |
| Q |
201 |
gaacatgatggaaggagattt |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
9277206 |
gaacattatggaaggagattt |
9277226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University