View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_38 (Length: 236)
Name: NF1771_low_38
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 31573402 - 31573602
Alignment:
| Q |
18 |
ataacaatattgctattgagtgatttacaggtatatatatggttttgttttgttacaacaaagaaacagtatggtagcactcacttagaaccactaaaga |
117 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
31573402 |
ataacaatattgctgttgagtgatttgcaggtatatatatggttttgttttgttacaacaaagaaacagtatgttagcactcacttagaaccacaaaaga |
31573501 |
T |
|
| Q |
118 |
caaagagaggaatattttagatcaaactaacacttgggacaagtttcatgtcaaaactgtatagtaacataaaacttagagaagagaatgggaaactgag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573502 |
caaagagaggaatattttagatcaaactaacacttgggacaagtttcatgtcaaaactgtctagtaacataaaacttagagaagagaatgggaaactgag |
31573601 |
T |
|
| Q |
218 |
a |
218 |
Q |
| |
|
| |
|
|
| T |
31573602 |
a |
31573602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University