View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1771_low_40 (Length: 235)
Name: NF1771_low_40
Description: NF1771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1771_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 51915211 - 51915431
Alignment:
| Q |
1 |
taccaccaccgggagaagccatgagatagcccttggagaagcttcgagcaccaatgagttttttgttacagagtgaagaatcgaaatctggtgctgattc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51915211 |
taccaccaccaggagaagccatgagatagcccttggagaagcttcgagcaccaatgagttttttgttacagagtgaagaatcgaaatctggtgctgattc |
51915310 |
T |
 |
| Q |
101 |
acactttccacgccatcgagatgggatttgaggcatttgagaatcgagaaaactttgcgattctggccatactccagtgtcaagtacaccaataacaacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51915311 |
acactttccacgccatcgagatgggatttgaggaatttgagaatcgtaaaaactttgcgattctggccatactccagtgtcaagtacaccaataacaacg |
51915410 |
T |
 |
| Q |
201 |
tcgtatgaaggttggtgaaga |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
51915411 |
tcgtatgaaggttggtgaaga |
51915431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University