View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17721_high_24 (Length: 314)

Name: NF17721_high_24
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17721_high_24
NF17721_high_24
[»] chr4 (1 HSPs)
chr4 (31-194)||(39822985-39823148)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 31 - 194
Target Start/End: Original strand, 39822985 - 39823148
Alignment:
31 aggcgtggtatgtttttaaccgggacaaatataaaatgtgattgagttggaaacatgactttgttgatttgatccctaaaggggtaggtgtgattcatgg 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39822985 aggcgtggtatgtttttaaccgggacaaatataaaatgtgattgagttggaaacatgactttgttgatttgatccctaaaggggtaggtgtgattcatgg 39823084  T
131 gtatgggtgcatgatactactcatggatttagtgtgaaatcagcttatagagaaaatatgaagg 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39823085 gtatgggtgcatgatactactcatggatttagtgtgaaatcagcttatagagaaaatatgaagg 39823148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University