View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_high_38 (Length: 237)
Name: NF17721_high_38
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_high_38 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 49921984 - 49921764
Alignment:
| Q |
17 |
aattggacggtggacttcttggcatccggtggaaagctcggctacggtacttaacgttgatggtagcagcttcggtaacccaggcatctctggctttgga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49921984 |
aattggacggtggacttcttggcatccggtggaaagctcggctacggtacttaacgttgatggtagtagcttcggtaacccaggcatctctggctttgga |
49921885 |
T |
 |
| Q |
117 |
ggagttttacgaagacatgatgggtcgtggatatatggctttggaggaaacattggtttttcatccattcttcaggctgagttgctggctctttatcatg |
216 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49921884 |
ggcgttttacgaagacatgatgggtcgtggatatatggctttggaggaaacattggtttttcatccattcttcaggctgagttgctggctctttatcatg |
49921785 |
T |
 |
| Q |
217 |
gtttgcgagttgcgtgggatc |
237 |
Q |
| |
|
||||| ||||||||| ||||| |
|
|
| T |
49921784 |
gtttgtgagttgcgtaggatc |
49921764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 13799475 - 13799692
Alignment:
| Q |
20 |
tggacggtggacttcttggcatccggtggaaagctcggctacggtacttaacgttgatggtagcagcttcggtaacccaggcatctctgg-ctttggagg |
118 |
Q |
| |
|
|||||| |||||||||||||| ||| |||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| || ||| ||| |
|
|
| T |
13799475 |
tggacgatggacttcttggcacccgatggagagctcggctacggtgcttaatgttgatggtagcagcttcggtaacccaggcatctccggtttttttagg |
13799574 |
T |
 |
| Q |
119 |
agttttacgaagacatgatgggtcgtggatatatggctttggaggaaacattggtttttcatccattcttcaggctgagttgctggctctttatcatggt |
218 |
Q |
| |
|
||||||| |||| |||||||| || |||||||| || |||||||| || |||||| || ||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
13799575 |
agttttaagaaggcatgatggctcttggatatacgggtttggagggaaaattggtattgcatccattcttcaggtggagttgctggctatttatcatggg |
13799674 |
T |
 |
| Q |
219 |
ttgcgagttgcgtgggat |
236 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
13799675 |
ttacgagttgcgtgggat |
13799692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University