View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_high_40 (Length: 213)
Name: NF17721_high_40
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 49514211 - 49514413
Alignment:
| Q |
1 |
tccatcaccattccacaagctgatttttgttgcaaattcaatgtatataattggtgcattattggtgaccaaatgagcactctaaaaatgagaacctggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49514211 |
tccatcaccattccacaagctgatttttgttgcaaattcaatgtatataattggtgcattattggtgaccaaatcagcactctaaaaatgagaacctggg |
49514310 |
T |
 |
| Q |
101 |
atggtcatggaaacccatatgagaaaagtatggaaggaaggagtgtatacgtccgtcccaccgaattcaatgtgatattttaatgcgtcttaacctttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49514311 |
atggtcatggaaacccatatgagaaaagtatggaaggaaggagtgtatacgtccgtcccaccgaattcaatgtgatattttaatgcgtcttaacctttgc |
49514410 |
T |
 |
| Q |
201 |
ttc |
203 |
Q |
| |
|
||| |
|
|
| T |
49514411 |
ttc |
49514413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University