View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_low_18 (Length: 387)
Name: NF17721_low_18
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 12 - 258
Target Start/End: Complemental strand, 43325315 - 43325040
Alignment:
| Q |
12 |
aagaaagttagcagccattatccaaacaaaccgttga--------gtaatcaatcaatctatccataagacttatggattcaccattcaaccgttttatc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325315 |
aagaaagttagcagccattatccaaacaaaccgttgattaatagagtaatcaatcaatctatccataagacttatggattcaccattcaaccgttttatc |
43325216 |
T |
|
| Q |
104 |
atcactggtacacgtcatccccatcggaaggaa---------------------acacaaacgcaccttgccggataacccaccccctgttctttttcct |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325215 |
atcactggtacacgtcatccccatcggaaggaactgacacagacacaaaaacaaacacaaacgcaccttgccggataacccaccccctgttctttttcct |
43325116 |
T |
|
| Q |
183 |
gttcctgtctaaattaggaaccgaagatgaaattgaagatgagtggttccacttccaccttcactcatttccctta |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43325115 |
gttcctgtctaaattaggaaccgaagatgaaattgaagatgagtggttccacttccaccttcactcatttccctta |
43325040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 323 - 363
Target Start/End: Complemental strand, 43324975 - 43324935
Alignment:
| Q |
323 |
aaactcaccacttcatcaccatgctcattcaagtaattcaa |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43324975 |
aaactcaccacttcatcaccatgctcattcaagtaattcaa |
43324935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University