View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_low_25 (Length: 314)
Name: NF17721_low_25
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 31 - 194
Target Start/End: Original strand, 39822985 - 39823148
Alignment:
| Q |
31 |
aggcgtggtatgtttttaaccgggacaaatataaaatgtgattgagttggaaacatgactttgttgatttgatccctaaaggggtaggtgtgattcatgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39822985 |
aggcgtggtatgtttttaaccgggacaaatataaaatgtgattgagttggaaacatgactttgttgatttgatccctaaaggggtaggtgtgattcatgg |
39823084 |
T |
|
| Q |
131 |
gtatgggtgcatgatactactcatggatttagtgtgaaatcagcttatagagaaaatatgaagg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39823085 |
gtatgggtgcatgatactactcatggatttagtgtgaaatcagcttatagagaaaatatgaagg |
39823148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University