View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_low_28 (Length: 280)
Name: NF17721_low_28
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 261
Target Start/End: Original strand, 46604029 - 46604274
Alignment:
| Q |
16 |
acatatcagtattttatagttgagatgacattcaaataaatgatttcaaaaataaactatttttt-agcagagttatgatatcaactctcccgacccttt |
114 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||| |||||||||||| ||| ||| |
|
|
| T |
46604029 |
acatattagtattttataattgagatgacattcaaatgaatgatttcaaaaataaactatttttttaggagagttatgttatcaactctcc-gacatttt |
46604127 |
T |
 |
| Q |
115 |
attgatatgttttcaccatttaagatatatgtttagaaagtttaaaaacatacattcacattgtaactataatttaatcctaatatgaataacatgtatg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46604128 |
gttgatatgttttcaccatttaagatatatgtttagaaagtttaaaaacatacattcacattgtaactataatttaatcctaatatgaataacatgtatg |
46604227 |
T |
 |
| Q |
215 |
ctcattaaaatgcattagatgatacatctacatgatcgactaacttt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46604228 |
ctcattaaaatgcattagatgatacatctacttgatcgactaacttt |
46604274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University