View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_low_35 (Length: 249)
Name: NF17721_low_35
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_low_35 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 145 - 249
Target Start/End: Complemental strand, 46873932 - 46873828
Alignment:
| Q |
145 |
aaaaccgcctctcaccatttctcaatcgtcactacaaaactcgcttctcatctcaatctctctcctagcatggccgccgtcacacttctcgctctcggta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873932 |
aaaaccgcctctcaccatttctcaatcgtcactacaaaactcgcttctcatctcaatctctctcctagcatggccgccgtcacacttctcgctctcggta |
46873833 |
T |
 |
| Q |
245 |
acggc |
249 |
Q |
| |
|
||||| |
|
|
| T |
46873832 |
acggc |
46873828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 13 - 73
Target Start/End: Complemental strand, 46874064 - 46874004
Alignment:
| Q |
13 |
aaaatcaccccatcttgccccattcaatccaatggcggcatcctcaactaccactgcattt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874064 |
aaaatcaccccatcttgccccattcaatccaatggcggcatcctcaactaccactgcattt |
46874004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University