View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17721_low_37 (Length: 245)
Name: NF17721_low_37
Description: NF17721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17721_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 45714587 - 45714379
Alignment:
| Q |
24 |
gtctctatcgttgccctatgttgcttcccgtcactgtagcaacatcttacagacagacttcaggtcattccacagctagcttgatatatagcaaccacaa |
123 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||| |||| ||||||| ||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
45714587 |
gtctctatcgctgccctatgttgcttcccgtctctgtagcagcatcctacagac----ttcagtccattccacaactagcttggtatatagcaaccacaa |
45714492 |
T |
|
| Q |
124 |
ttttatgtcaaacaatttcagtaacaccgtttggatttgatgcattaattacgtcacatatgtaaaataacagacaatctcaccgtttatgcaaaatcca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
45714491 |
ttttatgtcaaacaatttcagtaacaccgtttgtatttgatgcattaactacgtcacatatgtaaaataccagacaatctcactgtttatgcaaaatcca |
45714392 |
T |
|
| Q |
224 |
ctctcagaataat |
236 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
45714391 |
ctctcaaaataat |
45714379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University