View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17722_high_9 (Length: 356)
Name: NF17722_high_9
Description: NF17722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17722_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 34077567 - 34077218
Alignment:
| Q |
1 |
ctatcaacggctactgcattccttctaagactcgagtcttcatcaacacccatggattaggtcgaaacacgaagatttgggaaaatgtggatgagtttag |
100 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34077567 |
ctatcaacggctactacatcccttctaagactcgagtcttcatcaacacccatggattaggtcgaaacacgaagatttgggaaaatgtagatgagtttag |
34077468 |
T |
|
| Q |
101 |
gccggagaggcatttttcaactagcgggagtcgagttgagatcagccatggagctgattttaagatactgccttttagtgctggaaaacgcaaatgtccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34077467 |
gccggagaggcatttttcaactagcgggagtcgagttgagatcagccatggagctgattttaagatactgccttttagtgctggaaaacgcaagtgtccg |
34077368 |
T |
|
| Q |
201 |
ggtgcaccacttggagtcactttggttttaatggctttggctcgactgtttcattgttttgattggaacccacctaagggtttgaatcatcaagatattg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34077367 |
ggtgcaccacttggagtcactttggttttaatggctttggctcgattgtttcattgttttgattggaacccacctaagggtttgaatcatcaagatattg |
34077268 |
T |
|
| Q |
301 |
atactcaagaagtttatggaatgactatgcctaaggttcatcctttgatt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34077267 |
atactcaagaagtttatggaatgactatgcctaaggttcatcctttgatt |
34077218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University