View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17722_low_16 (Length: 292)
Name: NF17722_low_16
Description: NF17722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17722_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 255
Target Start/End: Original strand, 21410406 - 21410647
Alignment:
| Q |
11 |
gaacctgtgtcttatttccatattgtcatccttaattcgattataataacattttaaatgaatttaaatctcactctcaaaaaccatctcaaaggatgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
21410406 |
gaacctgtgtcttatttccatattgtcatccttaattcgactataataacattttaaatgaatttgaatctcactctcaaaagccatctcaaaggatgat |
21410505 |
T |
 |
| Q |
111 |
ggtacctaaaagtcatatgtacattcaaccatttgaaaattttaacaaagtgagacttcaatacaaattcaatattcaacctcctcatgcctagtgtaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21410506 |
ggtacctaaaagtcatatgtacattcaaccacttgaaaattttaacaaagtgagacttcaatacaaattcaatattcaa---cctcatgcctagtgtaaa |
21410602 |
T |
 |
| Q |
211 |
ttttggactcaattccacatatactgtacatccaacaaccggaga |
255 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21410603 |
ttttggactcaattccacatatattgtacatccaacaaccagaga |
21410647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University