View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17722_low_22 (Length: 228)
Name: NF17722_low_22
Description: NF17722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17722_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 86 - 212
Target Start/End: Complemental strand, 28800317 - 28800191
Alignment:
| Q |
86 |
caggaaacaatgaaactatacaaacatcgtttctagaataatttattgacacattaaagcctgtcctcgaactcggagagaggaatcagttgttccttta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28800317 |
caggaaacaatgaaactatacaaacatcgtttctagaataatttattgacacattaaagcctgtcctcgaactcggagagaggaatcagttgttccttta |
28800218 |
T |
 |
| Q |
186 |
aacctttcttttttcttatctcgacaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28800217 |
aacctttcttttttcttatctcgacaa |
28800191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 28800398 - 28800342
Alignment:
| Q |
16 |
taggacagtactattaagaaattacaattaaaatatttaaaatcacagcaacatgac |
72 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28800398 |
taggacagtactattaagaaattataattaaaatatttaaaatcacagcaacatgac |
28800342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University