View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17723_low_20 (Length: 340)
Name: NF17723_low_20
Description: NF17723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17723_low_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 7 - 340
Target Start/End: Complemental strand, 52543398 - 52543065
Alignment:
| Q |
7 |
tgctcttcaatggctcttacctcctcaaactttcaacaaaaaacacccttttgtctatactcaatgccaagccattcatgcccgttctgttttcccttgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543398 |
tgctcttcaatggctcttacctcctcaaactttcaacaaaaaacacccttttgtctatactcaatgccaagccattcatgcccgttctgttttcccttgt |
52543299 |
T |
|
| Q |
107 |
caggacacaccagccattagggtttgttattctgcccggttgaatattcccaaagaattgacggctgtcatggctgcaaaacatgtggcgcgccgcgaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
52543298 |
caggacacaccagccattagggtttgttattcggcccggttgaatattcccaaagaattgacggctgttatggctgcaaaacatgtggcgctccgcgaat |
52543199 |
T |
|
| Q |
207 |
cattggttgacgacgagtgttttgggaattcttggcaaggtagagtggtggaagagtttgagatggaacttccaattccaccttacctttttgcatttgc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52543198 |
cattggttgacgacgagtgttttgggaattcgtccaaaggtagagtggtggaagagtttgagatggaacttccaattccaccttacctttttgcatttgc |
52543099 |
T |
|
| Q |
307 |
agttggggagcttgataacagggaggtggggccc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52543098 |
agttggggagcttgataacagggaggtggggccc |
52543065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University