View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17723_low_33 (Length: 246)
Name: NF17723_low_33
Description: NF17723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17723_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 54038472 - 54038703
Alignment:
| Q |
1 |
tagttgttgtcgcttaattgcggtgggcaacataaggtgtgggaacataagggaagccagtgtggtcaaactaagtcgtgtctaagtaaaagaagataga |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54038472 |
tagttgttgtcgtttaattgcggtgggcaacataaggtgtgggaacataagggaagccagtgtggtcaaactaagtcgtgtctaagtaaaagaagataga |
54038571 |
T |
 |
| Q |
101 |
tgacaattggaaact---aaagaaaagaaagatagatgaaaataggaaactgtaagataaaattgagccatttaaacagcaaagtcaaactgtactgaaa |
197 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54038572 |
tgacaattggaaactgtaaaagaaaagaaagatagatgaaaataggaaactgtaagataaaattgagccatttaaacagcaaagtcaaactgtactgaaa |
54038671 |
T |
 |
| Q |
198 |
acagtatgaaattcatgacataaagtaaaacc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54038672 |
acagtatgaaattcatgacataaagtaaaacc |
54038703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University