View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17723_low_41 (Length: 202)
Name: NF17723_low_41
Description: NF17723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17723_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 183
Target Start/End: Complemental strand, 11468871 - 11468711
Alignment:
| Q |
23 |
atcaaactgcacattctttctatcaaggtttgtctaatcagccttggatttatcaaaggtgtcaccatcccttgcaatagtgggaaaattacttttctaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11468871 |
atcaaactgcacattctttctatcaaggtttgtctaatcagccttggatttatcaaaggtgtcaccatcccttgcaatagtgggaaaattacttttctaa |
11468772 |
T |
 |
| Q |
123 |
cttttaaaatttttcattcacacctgaaaattaccctaataactccaatgtaagttactcg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11468771 |
cttttaaaatttttcattcacacctgaaaattaccttaataactccaatgtaagttactcg |
11468711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 179
Target Start/End: Complemental strand, 7138398 - 7138326
Alignment:
| Q |
107 |
aaaattacttttctaacttttaaaatttttcattcacacctgaaaattaccctaataactccaatgtaagtta |
179 |
Q |
| |
|
||||||| | |||| |||||||||||| ||||| |||||| ||| ||| ||||||||| |||||| |||||| |
|
|
| T |
7138398 |
aaaattaatcttctcacttttaaaattgctcatttacacctaaaatttatcctaataaccccaatgcaagtta |
7138326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University