View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17725_low_5 (Length: 305)
Name: NF17725_low_5
Description: NF17725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17725_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 21 - 295
Target Start/End: Complemental strand, 51459247 - 51458973
Alignment:
| Q |
21 |
gtggacaaaacaacctcccattgaagaagaaaggttaaaattttcaattaattcattaagattaggttgaaaatatggaaggttgacccacctccgaatt |
120 |
Q |
| |
|
||||||| || |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51459247 |
gtggacagaaaaacctcacattaaagaagaaaggttaaaattttcaattaattcattaagattaggttgaaaatatggaaggttgacccacctccgaatt |
51459148 |
T |
 |
| Q |
121 |
agcttgggaaaagtatacagagccaccaaaatacactacgcaacttggtagctaatggagtacagaatcagaaattatcaaagttcataaccagttagga |
220 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51459147 |
agtttgggaaaagtatacagagccaccaaaatacactacgcaacttggtagctaatggagtacagaatgagaaattatcaaagttcataaccagttagga |
51459048 |
T |
 |
| Q |
221 |
gattattgtcttcatgtcttgcttcaccaccctctagctagtctagtatttatgctgttttaattctaacctttg |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51459047 |
gattattgtctttatgtcttgcttcaccaccctctagctagtctagtatttatgctgttttaattctaacctttg |
51458973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University