View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17726_low_13 (Length: 282)
Name: NF17726_low_13
Description: NF17726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17726_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 54177028 - 54177279
Alignment:
| Q |
16 |
ataaccactggtgtaagtactgccttataaacctgatcctctatgtatgctaacaaatatgatttaggttcattattttatcccaactggctaattcttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54177028 |
ataaccactggtgtaagtactgccttataaacctgatcctctatgtatgctaacaaatatgatttagcttcattattttatcccaactggctaattcttt |
54177127 |
T |
 |
| Q |
116 |
catttataccgaacagtattttgatggcgctgttggtgacattgccattgtcacaaatcggacaaggattgtagattttacacagccatatgctgcatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54177128 |
catttataccgaacagtattttgatggcgctgtaggtgacattgccattgtcacaaatcggacaaggattgtagattttacacagccatatgctgcatct |
54177227 |
T |
 |
| Q |
216 |
ggacttgttgtggttgctccttttaagaagatcaattctggtggatggtctt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
54177228 |
ggacttgttgtggttgctccttttaagaagatcaattccggcggatggtctt |
54177279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University