View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_14 (Length: 326)
Name: NF17727_low_14
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 18220862 - 18221013
Alignment:
| Q |
18 |
ttcactgctttctcagactttttatccccactgccactactcacaccttggtgatttttcttagactttttggccacgctgctactacttacaccttgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18220862 |
ttcactgctttctcagactttttatccccactgccactactcacaccttggtgatttttcttagactttttggccacgctgctactacttacaccttgtt |
18220961 |
T |
 |
| Q |
118 |
gatttttgttgcattgacgagtcaccctctgtacctcaaaaggagctacctt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18220962 |
gatttttgttgcattgacgagtcaccctctgtacctcaaaaggagctacctt |
18221013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 216 - 308
Target Start/End: Original strand, 18221060 - 18221152
Alignment:
| Q |
216 |
acaatagtccctactctggcgttaaaaatgacacctttttccttccgaatcacaggtaaaggttcaaccttttgctcctcatgacggcccaag |
308 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18221060 |
acaatagtccctactctggccttaaaaatgacacctttttccttctgaatcacaggtaaaggttcaaccttttgctcctcatgacggcccaag |
18221152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 74 - 174
Target Start/End: Original strand, 43012645 - 43012745
Alignment:
| Q |
74 |
tttcttagactttttggccacgctgctactacttacaccttgttgatttttgttgcattgacgagtcaccctctgtacctcaaaaggagctaccttgaca |
173 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
43012645 |
tttcttagattttttggctccgctgctactactcacaccttgttgatttttgttgcattgacgagttgtcctctgtacctcaaactgagctaccttgaca |
43012744 |
T |
 |
| Q |
174 |
g |
174 |
Q |
| |
|
| |
|
|
| T |
43012745 |
g |
43012745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 269 - 308
Target Start/End: Original strand, 43012828 - 43012867
Alignment:
| Q |
269 |
aggtaaaggttcaaccttttgctcctcatgacggcccaag |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43012828 |
aggtaaaggttcaaccttttgctcctcatgacgccccaag |
43012867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University