View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_18 (Length: 288)
Name: NF17727_low_18
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 278
Target Start/End: Original strand, 10417680 - 10417939
Alignment:
| Q |
19 |
ctttgtccctcataagttaatagcattaattggaaaacaaaataagtaggataagaaatgcgatgggttcatggagtctggttagttgagagacaaaaat |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10417680 |
ctttgtcactcataagttaatagcattaattggaaaacaaaataagtaggataagaaatgcgatgtgtttatggagtctggttagttgagagacaaaaat |
10417779 |
T |
|
| Q |
119 |
ctaattttaaggtgacaaaatggatccatctgtacatatcccatctaacccatcttaagcaaaatctatataaaattcatccatcaaacaagaaaaatct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10417780 |
ctaattttaaggtgacaaaatggatccatctgtacatatcccatctaacccatcttaagcaaaatctatataaaattcatccatcaaacaagaaaaatct |
10417879 |
T |
|
| Q |
219 |
aaaatacctgaattcaatccatacatttaacaccaaagattattttgaatccaccctttg |
278 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10417880 |
aaaatacctgaattcaatccatccatttaacgccaaagattattttgaatccaccctttg |
10417939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University