View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_22 (Length: 241)
Name: NF17727_low_22
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 60 - 241
Target Start/End: Original strand, 40870242 - 40870423
Alignment:
| Q |
60 |
gatgtgtagtcgtaatgctgggtgtgcaccatcaccagggtactaccctagttccaaagtaagcactattagctttgatcaagaatttagaaatctatgg |
159 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870242 |
gatgtgtagtcgtaatgctgggggtgcaccatcaccagggtactaccctagttccaaagtaagcactattagctttgatcaagaatttagaaatctatgg |
40870341 |
T |
|
| Q |
160 |
ggagctcagcatcagaaactagaccatggatcattatcaatctggcttgactctaccacaggtatatgaaatcaaatgtctc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870342 |
ggagctcagcatcagaaactagaccatggatcattatcaatctggcttgactctaccacaggtatatgaaatcaaatgtctc |
40870423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 241
Target Start/End: Complemental strand, 43100162 - 43100113
Alignment:
| Q |
192 |
attatcaatctggcttgactctaccacaggtatatgaaatcaaatgtctc |
241 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
43100162 |
attaacaatctggctcgactctacatcaggtatatgaaatcaaatgtctc |
43100113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University