View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_23 (Length: 239)
Name: NF17727_low_23
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41489783 - 41490006
Alignment:
| Q |
1 |
ctcctcacctgatcgaatttccacagccaaatccatccatcaggttttctatactgctattaataattaaatagttcaacacatcgatgcatatattgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
41489783 |
ctcctcacctgatcgaatttccacagccaaatccatccatcaggttttctatactgctattaataattaattagttcaacacatccatgcatatactgtg |
41489882 |
T |
|
| Q |
101 |
tttcaatattg---ataataactaagaaaaatttataggcatgcgttgagtatggnnnnnnnnaccttgtgaaccacggtgtggacgaggattttatcaa |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41489883 |
tttcaatattgataataataactaagaaaaatttataggcatgcgttgagtatggttttttttaccttgtgaaccacggtgtggacgaggattttatcaa |
41489982 |
T |
|
| Q |
198 |
acaagcattcgatcagagtgcaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41489983 |
acaagcattcgatcagagtgcaaa |
41490006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 131 - 221
Target Start/End: Original strand, 41480799 - 41480889
Alignment:
| Q |
131 |
tataggcatgcgttgagtatggnnnnnnnnaccttgtgaaccacggtgtggacgaggattttatcaaacaagcattcgatcagagtgcaaa |
221 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| | |||||||| || ||||| ||||| ||||||||||| |
|
|
| T |
41480799 |
tataggcatgtgttgagtatggtttcttttaccttgtgaaccacggtgtggacaaagattttatgaagcaagcgttcgagcagagtgcaaa |
41480889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University