View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_25 (Length: 235)
Name: NF17727_low_25
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 1663675 - 1663895
Alignment:
| Q |
1 |
gatccacaaacctcctaaatggttggataactacgtgggatcccttgaccaatttagaaatttagctaattacagctaccaaatctttttaagaactgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
1663675 |
gatccacaaacctcctaaatggttggataactacgtgggatcccttgaccaatttagaaatttagctatttacagctaccaaaacttttaaagaactgct |
1663774 |
T |
|
| Q |
101 |
atatcaaa--nnnnnnnnnnnnnnactttctgttatgctatattatctacaattgtggaaattctgttagtagaaggctctttaaatccctttatcattc |
198 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1663775 |
atatcaaatttttcatttttttttactttctgttatgctatgttatctacaattgtggcaattctgttagtagaaggctctttaaaaccctttatcattc |
1663874 |
T |
|
| Q |
199 |
aatgaataaagcaaacaaaat |
219 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
1663875 |
aatgaataaagcaagcaaaat |
1663895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 123 - 219
Target Start/End: Complemental strand, 22782981 - 22782885
Alignment:
| Q |
123 |
actttctgttatgctatattatctacaattgtggaaattctgttagtagaaggctctttaaatccctttatcattcaatgaataaagcaaacaaaat |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
22782981 |
actttttgttatgctatattatctacaattgtggccattctgttagtagaaggctctttaaaaccctttatcattcaatgaataaagtaagcaaaat |
22782885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University