View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_28 (Length: 222)
Name: NF17727_low_28
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_28 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41489395 - 41489616
Alignment:
| Q |
1 |
aaatctatctagtgtaatataataataataagcatacctagatgtgaacttttaatactaaataaagaagcaattgaattcaannnnnnnnnaactccat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
41489395 |
aaatttatctagtgtaatataataataataagcatacctagatgtgaactattaatactaaataaagaagcaattgaattcaatttttttttaactccgt |
41489494 |
T |
|
| Q |
101 |
caatgacgtattgttaaaaataatctgagtttaatatttagttgaaataatttttgattagattttacttttcaaccgaacaccggattaacaaagatat |
200 |
Q |
| |
|
| ||||| ||||||||| |||||||||||||| || |||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41489495 |
cgatgacatattgttaagaataatctgagtttgatttttagttgaaataatttttgatcaaattttacttttcaaccgaacactggattaacaaagatat |
41489594 |
T |
|
| Q |
201 |
tttttgtgagaaatgttaacac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41489595 |
tttttgtgagaaatgttaacac |
41489616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University