View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17727_low_31 (Length: 203)
Name: NF17727_low_31
Description: NF17727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17727_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 181
Target Start/End: Original strand, 50933253 - 50933424
Alignment:
| Q |
15 |
aatatggctcataggcatcagaaatttagttaaggtatcacatgtg-----atgagccgtgctcgatagctcgattcctctgccccttgctcctcttacg |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50933253 |
aatatgactcataggcatcagaaatttagttaaggtatcacatgtgtatatatgaaccgtgctcgatagctcgattcctctgccccttgctcctcttacg |
50933352 |
T |
 |
| Q |
110 |
tgtgaatcatactaaacatgcattatgctgacaacaatacacaagttccataactgaaactcgaaagcaagt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50933353 |
tgtgaatcatactaaacatgcattatgctgacaacaatacacaagttccataactgaaactcgaatgcaagt |
50933424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University