View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17729_low_2 (Length: 385)
Name: NF17729_low_2
Description: NF17729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17729_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 12 - 362
Target Start/End: Complemental strand, 49449139 - 49448789
Alignment:
| Q |
12 |
tattctgcagcagattgttgatttaaaaaggtttcagctaatagaggagagggatcattctacaaagataaatgggttacaagtggatgaaaaattcaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49449139 |
tattctgcagcagattgttgatttaaaaaggtttcagctaatagaggagagggatcattctacaaagataaatgggctacaagtggatgaaaaattcaat |
49449040 |
T |
 |
| Q |
112 |
caacaagcacaaaaatccaagtattttggtattaatctgctgggagaagacaattctatcggggagctgaaccccgaaactttctcttctgcattttctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49449039 |
caacaagcacaaaaatccaagtattttggtattaatctgctgggagaagacaattctatcggggagctgaaccccgaaactttctcttctgcattttctc |
49448940 |
T |
 |
| Q |
212 |
aacttgataatttgtcttcatcttcagttatggaccttcccttgcatggagagttattttggactgctaagagttcactacaaagtaaccaggtcagata |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49448939 |
aacttgataatttgtcttcatcttcagttatggaccttcccttgcatggagagttattttggactgctaagagttcactacaaagtaaccaggtcagata |
49448840 |
T |
 |
| Q |
312 |
cttatctatccactgttgtgagccacaattgaaaggaaacatacattatgt |
362 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49448839 |
cttatctatccactattgtgagccacaattgaaaggaaacatacattatgt |
49448789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University