View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17729_low_6 (Length: 244)
Name: NF17729_low_6
Description: NF17729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17729_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 22273652 - 22273426
Alignment:
| Q |
1 |
gtcacataaggatacctaaaaatcaaaccaacatttaggtcaatttcaaaacaaa-tcgatgaacaaacaaaataaactatctcaattttcgcgttgcac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22273652 |
gtcacataaggatacctaaaaatcaaaccaacatttaggtcaatttcaaaacaaaatcgatgaacaaacaaaataaactatctcaattttcgcgttgcac |
22273553 |
T |
 |
| Q |
100 |
aaaaccttaaactgagtaaattgaaaaacacacacgccaacgaatgaattcactagagagagaaagaagggacatacaaggttctctgtgattctgcaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22273552 |
aaaaccttaaactgagtaaattgaaaaacacacacaccaacgaatgaattcactagagagagaaagaagggacatacaaggttctctgtgattctgcaat |
22273453 |
T |
 |
| Q |
200 |
agagtccattgtttgatttgtcgaatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22273452 |
agagtccattgtttgatttgtcgaatg |
22273426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University