View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1772_high_13 (Length: 239)
Name: NF1772_high_13
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1772_high_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 29096306 - 29096087
Alignment:
| Q |
19 |
accatctcttcttgcgttatcttgagctttggtgcttccaaaatgtaacgaagttctgcagcttgacgtttgatgctaatactagggtgcgacttttcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29096306 |
accatctcttcttgcgttatcttgagctttggtgcttccaaaatgtaacgaagttctgcagcttgacgtttgatgctaatactagggtgcgaattttcta |
29096207 |
T |
 |
| Q |
119 |
attgcttgtaaagatcaatgcaatctttatggcgattattggcctcataagccatagccagccatatttgtatctgaaattcacaannnnnnnnaataaa |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29096206 |
attgcttgtaaagagcaatgcaatctttatggcgattattggcctcataagccatagccagccatatttgtatctgaaattcacaa-tttttttaataaa |
29096108 |
T |
 |
| Q |
219 |
aagactccttttacttactct |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29096107 |
aagactccttttacttactct |
29096087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University