View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1772_high_15 (Length: 224)
Name: NF1772_high_15
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1772_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 3e-56; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 63 - 209
Target Start/End: Complemental strand, 1952288 - 1952142
Alignment:
| Q |
63 |
cctatgtatgtttattattaagggaacatggataatatagttgagttgatggaggagggtattcgtacaaagaaaagaaaaacatctatgatggacattt |
162 |
Q |
| |
|
||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
1952288 |
cctatgtatgtttattattaaggaaggaaggataatatagttgagttgatggaggagggtattcgtataaagaaaagaaaagcatctatgatggtcattt |
1952189 |
T |
|
| Q |
163 |
tcttcactacgtcatgaaaatctttatggaaggaatgttgtataact |
209 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1952188 |
tcttcactacttcatggaaatctttatggaaggaatgttgtataact |
1952142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 199
Target Start/End: Complemental strand, 1922998 - 1922907
Alignment:
| Q |
108 |
ttgatggaggagggtattcgtacaaagaaaagaaaaacatctatgatggacattttcttcactacgtcatgaaaatctttatggaaggaatg |
199 |
Q |
| |
|
|||||| || |||||||| ||||| |||| |||||| |||| | |||||||||||| ||||| | ||||| ||||||||||||| |||||| |
|
|
| T |
1922998 |
ttgatgaagaagggtatttgtacatagaagagaaaagcatcaaagatggacattttggtcactgcttcatggaaatctttatggatggaatg |
1922907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 50
Target Start/End: Complemental strand, 1952389 - 1952360
Alignment:
| Q |
21 |
ataaattgttctcataagttcttcaaaaaa |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1952389 |
ataaattgttctcataagttcttcaaaaaa |
1952360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University