View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1772_low_10 (Length: 313)
Name: NF1772_low_10
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1772_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 186 - 299
Target Start/End: Original strand, 3608799 - 3608912
Alignment:
| Q |
186 |
tgattctaaacaatgcaatcaagatccaagattatattttcaccccctaatttttcttcacttttaagtgatttagttatgtgactttgttgatccatct |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3608799 |
tgattctaaacaatgcaatcaagatccaagattatattttcaccccctaaattttcttcacttttaagtgatttagttatgtgactttgttgatccatct |
3608898 |
T |
|
| Q |
286 |
tattcattgttttt |
299 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
3608899 |
tactcattgttttt |
3608912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 3608621 - 3608732
Alignment:
| Q |
8 |
attatactttctcattagtaggtcataaaatttgacttcgagttaactaacaaagattgatatgaaatataggcaacaagtgtggtgaatgtacaaaaat |
107 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3608621 |
attagactttctccttagtaggtcataaaatttgacttcgagttaactaacaaagattgatatgaaatataggcaataagtgtggtgaatgtacaaaaat |
3608720 |
T |
|
| Q |
108 |
acaaaggtgcgc |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3608721 |
acaaaggtgcgc |
3608732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University