View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1772_low_17 (Length: 236)
Name: NF1772_low_17
Description: NF1772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1772_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 220
Target Start/End: Original strand, 23922027 - 23922062
Alignment:
| Q |
185 |
tagcaacttttctttctaaaattgccatgtaccttc |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23922027 |
tagcaacttttctttctaaaattgtcatgtaccttc |
23922062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 101
Target Start/End: Original strand, 23921915 - 23921943
Alignment:
| Q |
73 |
ttcaagattagtaactaacaattactatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23921915 |
ttcaagattagtaactaacaattactatt |
23921943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University